This book contains contributions of leading international scientists who participated at the NATO-ASI conference 'Stem cells and their potential for clinical application' that was held in Kiev and Simeiz (Ukraine) from August 23 - 31, 2006. The articles cover a broad range of hot topics in stem cell and leukaemia research. Those include the potential of various stem cell types in regenerative and transplantation medicine, different mechanisms of malignant transformation leading to leukaemia development, as well as novel clinical strategies for malignant disease treatment such as adoptive immunotherapy with gene-modified lymphocytes. The mixture of articles by principal scientists from Northern America, as well as Eastern and Western Europe, provides a comprehensive overview on 'What's going on' in various parts of the world in such broadly discussed fields as 'stem cell research', 'immunotherapy' or 'gene therapy'.

Helper T cells activate a set of lymphokine genes upon recognition of antigens presented in the context of the major histocompatibility complex on antigen presenting cells (Arai et al. , 1986; Miyajima et al. , 1988). Activation of T cells proceeds in two distinct stages. The flrst step is triggered by binding of an antigen to the T cell antigen receptor/CD3 complex that leads to the activation of protein kinase C (PKC) and an increase in intracellular Ca2+. This step, which is substituted by phorbol ester and calcium ionophore (Weiss et al. , 1984), possibly proceeds through GTP binding protein and phospholipase C. The second step is the downstream events of PKC activation for transmission of the intracellular signals to the nucleus and is likely to involve protein phosphorylation. In this review, we focus on the downwstream events of PKC activa- tion for activation of lymphokine genes. To characterize a series of biochemical reactions, we toke several approaches to (1) deflne the regulatory region of the GM-CSF and other lymphokine genes that mediates the response to T cell activation signals or viral transactivators, (2) develop a faithful in vitro transcription system of lymphokine genes which is dependent on regulatory sequence and activation signals, (3) characterize proteins that interact with the regulatory regions, and (4) search for critical target(s) for PKC activation. CLEl CLE2 GC box GGCCAGGAGATTCCACAACTCAGGTAGTTCCCCCGCCCCCCTGGAGTTCTGTGG -72 -60 -113 * -96 -84 GGAGATTCCCC IL-2R (p55) ...

The 11 th meeting in "Modern Trends in Human Leukemia" took place from June 19 to 21, 1994 in Wilsede in the middle of the Liineburger Heide, South of Hamburg. Interwoven with the Leukemia program was the Nato-sponsored Symposium of the ASI-Series "Gene Technology in Analysis of Malignant and Inherited Human Diseases Related to Development" . The Wilsede meeting was continued on a ship of the Neva leading through lake Ladoga and lake Onega. The topics of both meetings included discussion on recent progress isolation and development of hematopoietic stem cells, genes crucial for development and diseases, methods of gene transfer, application of gene transfer; oncogenes and anti-oncogenes as targets for gene therapy; receptors and their ligands in normal development and diseases, immunology and immunotherapy, radiation biology, clinical leukemias and bone marrow transplantation. The Nato workshop concentrated not only on analysis of cell systems useful for somatic gene therapy, but also on actual themes directly related to correction of human diseases. The latter aspects emphasized themes related to biotechnology, the first part was by nature more general. We also included a few contributions that discussed perspectives for the future of gene therapy and possible relationships to evolution.

This book contains contributions of leading international scientists who participated at the NATO-ASI conference Stem cells and their potential for clinical application that was held in Kiev and Simeiz (Ukraine) from August 23 - 31, 2006. The articles cover a broad range of hot topics in stem cell and leukaemia research. These include the potential of various stem cell types in regenerative and transplantation medicine, different mechanisms of malignant transformation leading to leukaemia development, as well as novel clinical strategies for malignant disease treatment such as adoptive immunotherapy with gene-modified lymphocytes. The mixture of articles by principal scientists from Northern America, as well as Eastern and Western Europe, provides a comprehensive overview on area such as stem cell research, immunotherapy and gene therapy. Thus, this compilation should be valuable for readers interested in modern biomedicine who have background knowledge in those areas.