Welcome to Loot.co.za!
Sign in / Register |Wishlists & Gift Vouchers |Help | Advanced search
|
Your cart is empty |
|||
Showing 1 - 20 of 20 matches in All Departments
How did an obscure academic idea pave the way to the Holocaust within just fifty years? Why does eugenics still loom large in the 21st century, despite its genocidal past? Did eugenics work? Could it work? Or was it always a pseudoscientific fantasy? Throughout history, people have sought to reduce suffering, eliminate disease and enhance desirable qualities in their children. In the Victorian era eugenics, a full-blooded attempt to impose control over unruly biology, began to grow among the powerful and quickly spread to dozens of countries around the world. But these ideas are not merely historical: today, with new gene editing techniques, conversations are happening about tinkering with the DNA of our unborn children to make them smarter, fitter, stronger. Deeply steeped in contemporary genetics, CONTROL offers a vital account of one of the defining - and most destructive - ideas of the twentieth century.
Control is a book about eugenics, what geneticist Adam Rutherford calls "a defining idea of the twentieth century." Inspired by Darwin's ideas about evolution, eugenics arose in Victorian England as a theory for improving the British population, and quickly spread to America, where it was embraced by presidents, funded by Gilded Age monopolists, and enshrined into racist American laws that became the ideological cornerstone of the Third Reich. Despite this horrific legacy, eugenics looms large today as the advances in genetics in the last thirty years-from the sequencing of the human genome to modern gene editing techniques-have brought the idea of population purification back into the mainstream. Eugenics has "a short history, but a long past," Rutherford writes. The first half of Control is the history of an idea, from its roots in key philosophical texts of the classical world all the way into their genocidal enactment in the twentieth century. The second part of the book explores how eugenics operates today, as part of our language and culture, as part of current political and racial discussions, and as an eternal temptation to powerful people who wish to improve society through reproductive control. With disarming wit and scientific precision, Rutherford explains why eugenics still figures prominently in the twenty-first century, despite its genocidal past. And he confronts insidious recurring questions-did eugenics work in Nazi Germany? And could it work today?-revealing the intellectual bankruptcy of the idea, and the scientific impossibility of its realization.
'Laugh out loud funny - and you'll learn lots too!' - Adam Kay, author of Kay's Anatomy Who do you think you are? Have you ever thought about who you might be related to? What if we told you that you were related to EXTRAORDINARY EMPERORS, GREAT KINGS and MAGNIFICENT QUEENS? Well, your majesty, you are. In fact, everyone is. And geneticist Adam Rutherford is here to tell you how. Come on an extraordinary adventure through millions of years of human history where you will learn the story of our species from evolution to dinosaurs to YOU! You will meet kings and queens, pharaohs and vikings, and see just how far and wide humans have migrated around the world. You'll discover why we're related fo a super cheesy man and that no matter what skin colour you have, language you speak or place you are from - we all share the same small pool of ancestors. Armed with a deeper understanding of science and history, readers will learn how to dismantle common myths of who we really are - like what race is, where we come from, and what it means to be human. Mind-boggling, entertaining and illuminating, this is the epic story of you and everyone who has ever lived! 'A BRILLIANT book about biology and belonging. Packed to its covers with fascinating facts, science and joy; I have a ten year old son who will LOVE this book.' - Dr Alice Roberts, author of The Incredible Human Journey 'Funny, silly and utterly rigorous - a book that will inspire awe and wonder in all that read it. It stands a better chance of making the world a better place than any book I've read recently.' - Dr Chris van Tullekan, author of the Operation Ouch series and the recent bestseller, Ultra Processed People
THE SUNDAY TIMES BESTSELLER AS HEARD ON BBC RADIO 4 BOOK OF THE WEEK 'The ultimate anti-racism guide' Caroline Criado Perez 'Seriously important' Bill Bryson 'A fascinating debunking of racial pseudoscience' Guardian Racist pseudoscience may be on the rise, but science is no ally to racists. Instead science and history can be powerful allies against bigotry, granting us the clearest view of how people actually are, rather than how we judge them to be. HOW TO ARGUE WITH A RACIST dismantles outdated notions of race by illuminating what modern genetics can and can't tell us about human difference. It is a vital manifesto for a twenty-first century understanding of human evolution and variation, and a timely weapon against the misuse of science to justify racism. Updated edition includes a new Preface from the author
THE SUNDAY TIMES BESTSELLER 'Explores just about every area of life' DAILY MAIL 'If only Adam Rutherford and Hannah Fry were on tap to all of us, all the time . . . The pair have such a gift for making life, numbers and the forces at work in the universe all the richer, stranger, funnier and more marvellous.' Stephen Fry In Rutherford and Fry's comprehensive guidebook, they tell the complete story of the universe and absolutely everything in it - skipping over some of the boring parts. This is a celebration of the weirdness of the cosmos, the strangeness of humans and the fact that amid all the mess, we can somehow make sense of life. Our brains have evolved to tell us all sorts of things that feel intuitively right but just aren't true: the world looks flat, the stars seem fixed in the heavenly firmament, a day is 24 hours... This book is crammed full of tales of how stuff really works. With the power of science, Rutherford and Fry show us how to bypass our monkey-brains, taking us on a journey from the origin of time and space, via planets, galaxies, evolution, the dinosaurs, all the way into our minds, and wrestling with some truly head-scratching questions that only science can answer: What is time, and where does it come from? Why are animals the size and shape they are? How horoscopes work (Spoiler: they don't, but you think they do) Does my dog love me? Why nothing is truly round? Do you need your eyes to see? 'A wonderfully engaging blend of wit, enthusiasm, clarity and knowledge.' Bill Bryson 'Like the universe itself, this book is multi-faceted, surprising and full of wonders. It's also funny, wise and exceedingly brainy. You really owe it to yourself to read it.' Tim Harford, author of How To Make The World Add Up
Despite our clever linguistic abilities, humans are spectacularly ill-equipped to comprehend what's happening in the universe. Our senses and intuition routinely mislead us. The Complete Guide to Absolutely Everything (Abridged) tells the story of how we came to suppress our monkey minds and perceive the true nature of reality. Written with wit and humor, this brief book tells the story of science-tales of fumbles and missteps, errors and egos, hard work, accidents, and some really bad decisions-all of which have created the sum total of human knowledge. Geneticist Adam Rutherford and mathematician Hannah Fry guide readers through time and space, through our bodies and brains, showing how emotions shape our view of reality, how our minds tell us lies, and why a mostly bald and curious ape decided to begin poking at the fabric of the universe. Rutherford and Fry shine as science sleuths, wrestling with some truly head-scratching questions: Where did time come from? Do we have free will? Does my dog love me? Hilarious sidebars present memorable scientific oddities: for example, hypnotized snails, human-sized ants, and the average time it takes most animals to evacuate their bladders. (A surprisingly consistent twenty-one seconds, if you must know.) Both rigorous and playful, The Complete Guide to Absolutely Everything (Abridged) is a celebration of the weirdness of the cosmos, the strangeness of humans, and the joys and follies of scientific discovery.
'A brilliant, authoritative, surprising, captivating introduction to human genetics. You'll be spellbound' Brian Cox This is a story about you. It is the history of who you are and how you came to be. It is unique to you, as it is to each of the 100 billion modern humans who have ever drawn breath. But it is also our collective story, because in every one of our genomes we each carry the history of our species - births, deaths, disease, war, famine, migration and a lot of sex. In this captivating journey through the expanding landscape of genetics, Adam Rutherford reveals what our genes now tell us about human history, and what history can now tell us about our genes. From Neanderthals to murder, from redheads to race, dead kings to plague, evolution to epigenetics, this is a demystifying and illuminating new portrait of who we are and how we came to be. *** 'A thoroughly entertaining history of Homo sapiens and its DNA in a manner that displays popular science writing at its best' Observer 'Magisterial, informative and delightful' Peter Frankopan 'An extraordinary adventure...From the Neanderthals to the Vikings, from the Queen of Sheba to Richard III, Rutherford goes in search of our ancestors, tracing the genetic clues deep into the past' Alice Roberts
* FROM THE SUNDAY TIMES BESTSELLING AUTHOR OF HOW TO ARGUE WITH A RACIST * Throughout history, people have sought to improve society by reducing suffering, eliminating disease or enhancing desirable qualities in their children. But this wish goes hand in hand with the desire to impose control over who can marry, who can procreate and who is permitted to live. In the Victorian era, in the shadow of Darwin's ideas about evolution, a new full-blooded attempt to impose control over our unruly biology began to grow in the clubs, salons and offices of the powerful. It was enshrined in a political movement that bastardised science, and for sixty years enjoyed bipartisan and huge popular support. Eugenics was vigorously embraced in dozens of countries. It was also a cornerstone of Nazi ideology, and forged a path that led directly to the gates of Auschwitz. But the underlying ideas are not merely historical. The legacy of eugenics persists in our language and literature, from the words 'moron' and 'imbecile' to the themes of some of our greatest works of culture. Today, with new gene editing techniques, very real conversations are happening - including in the heart of British government - about tinkering with the DNA of our unborn children, to make them smarter, fitter, stronger. CONTROL tells the story of attempts by the powerful throughout history to dictate reproduction and regulate the interface of breeding and society. It is an urgently needed examination that unpicks one of the defining and most destructive ideas of the twentieth century. To know this history is to inoculate ourselves against its being repeated.
*FROM THE BESTSELLING AUTHOR OF A BRIEF HISTORY OF EVERYONE WHO EVER LIVED and HOW TO ARGUE WITH A RACIST* WHAT MAKES US HUMAN? Waging war? Sex for pleasure? Creating art? Mastery of fire? In this thrilling tour of the animal kingdom, Adam Rutherford tells the story of how we became the unique creatures we are today. Illuminated by the latest scientific discoveries, THE BOOK OF HUMANS is a dazzling compendium of what unequivocally fixes us as animals, and reveals how we are extraordinary among them. *** 'Adam Rutherford is a superb communicator, who eruditely explores the borderlands of history, archaeology, genetics and anthropology in this fascinating tour of our species' DAN SNOW 'This superbly accessible discussion about who we humans really are is important and necessary' CHRIS PACKHAM 'Charming, compelling and packed with information. I learned more about biology from this short book than I did from years of science lessons' PETER FRANKOPAN 'An outstandingly clear and witty account that shows beyond doubt how much we are part of the animal world, and yet at the same time how different we have become' HENRY MARSH
Dieses Buch ist ein wichtiges Manifest fur das Verstandnis der menschlichen Evolution und Variation im 21. Jahrhundert. Es leistet einen bedeutenden Beitrag zur aktuellen Diskussion uber die Rasse. Klischees und Mythen uber Rassen werden nicht nur von offenkundigen Rassisten zum Ausdruck gebracht. Auch gut meinende Menschen vertreten durch ihren kulturellen Erfahrungshorizont Ansichten, die nicht durch die moderne Humangenetik gestutzt werden. Sogar der wissenschaftliche Rassismus greift zunehmend um sich und beeinflusst den oeffentlichen Diskurs uber Politik, Migration, Bildung, Sport und Intelligenz. Der Leser bekommt Argumente an die Hand, um dem entgegen zu treten. Adam Rutherford zeigt, dass die moderne Humangenetik ein machtiger Verbundeter gegen Rassismus sein kann. Sie zeigt, wie Menschen tatsachlich sind, und nicht, wie sie von der Gesellschaft gesehen werden.
Thought the science of the future was all hoverboards and space travel? Think again. Every day, scientists come up with the ingenious solutions and surprising discoveries that will define our future. So here, Jim Al-Khalili and his crack team of experts bin the crystal ball and use cutting-edge science to get a glimpse of what's in store. From whether teleportation is really possible (spoiler: it is), to what we'll do if artificial intelligence takes over, What's Next? takes on the big questions. And along the way, it'll answer questions like: Will we find a cure to all diseases? An answer to climate change? Will bionics make us into superheroes? Touching on everything from genetics to transport, and nanotechnology to teleportation, What's Next? is a fascinating, fun and informative look at what's in store for the human race.
Vor etwa 45.000 Jahren haben wir Menschen uns mit der Schaffung von Kultur, Werkzeugen, Symbolik und Kunst von unseren Vorfahren und Ursprungen entfernt. Diese "kognitive Revolution" gab uns das Gefuhl, dass wir etwas Besonderes sind. Schriftsteller, Wissenschaftler, Philosophen und Religionen staunen seit Jahrtausenden uber unsere Brillanz. Dennoch sind wir mit dem Rest der Natur durch Gene, Anatomie und Physiologie verbunden und in einer gemeinsamen Evolution verwurzelt. Alle Arten sind einzigartig, aber sind wir einzigartiger als andere Tiere? Diese Frage geht an die Wurzel dessen, was wir sind. Doch viele wissenschaftliche Erkenntnisse haben im Laufe der Zeit Zweifel an der Sonderstellung des Menschen aufkommen lassen. Dinge, die wir einst als einzigartig menschlich betrachtet haben, sind es nicht. Wir sind nicht die einzige Spezies, die z.B. Plane fur die Zukunft schmiedet, vergangene Entscheidungen bereut, um verlorene Leben trauert und Sex aus anderen Grunden als der Zeugung von Nachkommen hat.
We like to think of ourselves as exceptional beings, but are we really any more special than other animals? Humans are the slightest of twigs on a single family tree that encompasses four billion years, a lot of twists and turns, and a billion species. All of those organisms are rooted in a single origin, with a common code that underwrites our existence. This paradox - that our biology is indistinct from all life, yet we consider ourselves to be special - lies at the heart of who we are. In this original and entertaining tour of life on Earth, Adam Rutherford explores how many of the things once considered to be exclusively human are not: we are not the only species that communicates, makes tools, utilises fire, or has sex for reasons other than to make new versions of ourselves. Evolution has, however, allowed us to develop our culture to a level of complexity that outstrips any other observed in nature. THE BOOK OF HUMANS tells the story of how we became the creatures we are today, bestowed with the unique ability to investigate what makes us who we are. Illuminated by the latest scientific discoveries, it is a thrilling compendium of what unequivocally fixes us as animals, and reveals how we are extraordinary among them. With illustrations by Alice Roberts
Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a thrilling solution. 'A superbly written explanation' Brian Cox This same science has led to a technological revolution: the ability to create entirely new life forms within the lab, known as synthetic biology. The Future of Life introduces these remarkable innovations, explains how they work, and presents a powerful argument for their benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating.' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford argues persuasively against those who seek to hold back scientific progress. His illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
This is a new release of the original 1948 edition.
1948. The controversy of the Cubits settled. The author attempts to settle the controversy between the Egyptologists and Pyramidologists regarding the battle of the Cubits. It harmonizes pyramidology, Egyptology, archeology and biblical chronology in regard to the perplexing problems full of contradiction and confusion. Includes many diagrams and tables of the Great Pyramid, its interior structure and mathematical relationships of cubits.
1948. The controversy of the Cubits settled. The author attempts to settle the controversy between the Egyptologists and Pyramidologists regarding the battle of the Cubits. It harmonizes pyramidology, Egyptology, archeology and biblical chronology in regard to the perplexing problems full of contradiction and confusion. Includes many diagrams and tables of the Great Pyramid, its interior structure and mathematical relationships of cubits.
1948. The controversy of the Cubits settled. The author attempts to settle the controversy between the Egyptologists and Pyramidologists regarding the battle of the Cubits. It harmonizes pyramidology, Egyptology, archeology and biblical chronology in regard to the perplexing problems full of contradiction and confusion. Includes many diagrams and tables of the Great Pyramid, its interior structure and mathematical relationships of cubits.
The controversy of the Cubits settled. The author attempts to settle the controversy between the Egyptologists and Pyramidologists regarding the battle of the Cubits. It harmonizes pyramidology, Egyptology, archeology and biblical chronology in regard to the perplexing problems full of contradiction and confusion. Includes many diagrams and tables of the Great Pyramid, its interior structure and mathematical relationships of cubits.
|
You may like...
Birds Of Greater Southern Africa
Keith Barnes, Terry Stevenson, …
Paperback
(5)
|