Books > Science & Mathematics > Biology, life sciences > Life sciences: general issues > Evolution
|
Buy Now
Creation - The Origin of Life / The Future of Life (Paperback)
Loot Price: R306
Discovery Miles 3 060
You Save: R31
(9%)
|
|
Creation - The Origin of Life / The Future of Life (Paperback)
(sign in to rate)
List price R337
Loot Price R306
Discovery Miles 3 060
You Save R31 (9%)
Expected to ship within 9 - 17 working days
|
Creation by Adam Rutherford tells the entire spellbinding story of
life in two gripping narratives. 'Prepare to be astounded. There
are moments when this book is so gripping it reads like a thriller'
Mail on Sunday The Origin of Life is a four-billion-year detective
story that uses the latest science to explain what life is and
where it first came from, offering answers to the very grandest of
questions before arriving at a thrilling solution. 'A superbly
written explanation' Brian Cox This same science has led to a
technological revolution: the ability to create entirely new life
forms within the lab, known as synthetic biology. The Future of
Life introduces these remarkable innovations, explains how they
work, and presents a powerful argument for their benefit to
humankind. 'The reader's sense of awe at the well-nigh
inconceivable nature of nature is suitably awakened. The
extraordinary science and Rutherford's argument are worth every
reader's scrutiny. Fascinating.' Sunday Telegraph 'One of the most
eloquent and genuinely thoughtful books on science over the past
decade. You will not find a better, more balanced or up-to-date
take on the origin of life or synthetic biology. Essential reading
for anyone interested in the coming revolution, which could indeed
rival the Industrial Revolution or the internet' Observer 'The
perfect primer on the past and future of DNA' Guardian 'Susenseful,
erudite and thrilling' Prospect 'A witty, engaging and eye-opening
explanation of the basic units of life, right back to our common
ancestors and on to their incredible synthetic future. The mark of
a really good science book, it shows that the questions we still
have are just as exciting as the answers we already know' Dara O
Briain 'This is a quite delightful two-books-in-one. Rutherford's
lightness of touch in describing the dizzying complexity of life at
the cellular level in The Origin of Life only serves to emphasise
the sheer scale and ambition of the emerging field of synthetic
biology' Jim Al Khalili 'A fascinating glimpse into our past and
future. Rutherford argues persuasively against those who seek to
hold back scientific progress. His illuminating book is full of
optimism about what we might be able to achieve' Sunday Times
'Fresh, original and excellent. An eye-opening look at how we are
modifying and constructing life. Totally fascinating'
PopularScience.co.uk 'In this book of two halves, Rutherford tells
the epic history of life on earth, and eloquently argues the case
for embracing technology which allows us to become biological
designers' Alice Roberts 'An engaging account of both the mystery
of life's origin and its impending resolution as well as a
fascinating glimpse of the impending birth of a new, synthetic
biology'' Matt Ridley, author of Genome 'I warmly recommend
Creation. Rutherford's academic background in genetics gives him a
firm grasp of the intricacies of biochemistry - and he translates
these superbly into clear English' Financial Times Dr Adam
Rutherford is a geneticist, writer and broadcaster. He presents BBC
Radio 4's weekly programme Inside Science and his documentaries
include the award-winning series The Cell (BBC4), The Gene Code
(BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other
programmes for BBC Radio 4. This is his first book.
TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG
General
Is the information for this product incomplete, wrong or inappropriate?
Let us know about it.
Does this product have an incorrect or missing image?
Send us a new image.
Is this product missing categories?
Add more categories.
Review This Product
No reviews yet - be the first to create one!
|
|
Email address subscribed successfully.
A activation email has been sent to you.
Please click the link in that email to activate your subscription.