0
Your cart

Your cart is empty

Books > Science & Mathematics > Biology, life sciences > Life sciences: general issues > Evolution

Buy Now

Creation - The Origin of Life / The Future of Life (Paperback) Loot Price: R288
Discovery Miles 2 880
You Save: R28 (9%)

Creation - The Origin of Life / The Future of Life (Paperback)

Adam Rutherford

 (sign in to rate)
List price R316 Loot Price R288 Discovery Miles 2 880 You Save R28 (9%)

Bookmark and Share

Expected to ship within 9 - 17 working days

Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a thrilling solution. 'A superbly written explanation' Brian Cox This same science has led to a technological revolution: the ability to create entirely new life forms within the lab, known as synthetic biology. The Future of Life introduces these remarkable innovations, explains how they work, and presents a powerful argument for their benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating.' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford argues persuasively against those who seek to hold back scientific progress. His illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

General

Imprint: Penguin Books
Country of origin: United Kingdom
Release date: February 2014
Authors: Adam Rutherford
Dimensions: 198 x 129 x 21mm (L x W x T)
Format: Paperback
Pages: 272
ISBN-13: 978-0-241-95469-0
Categories: Books > Science & Mathematics > Science: general issues > Popular science
Books > Science & Mathematics > Biology, life sciences > Life sciences: general issues > Evolution
Promotions
LSN: 0-241-95469-X
Barcode: 9780241954690

Is the information for this product incomplete, wrong or inappropriate? Let us know about it.

Does this product have an incorrect or missing image? Send us a new image.

Is this product missing categories? Add more categories.

Review This Product

No reviews yet - be the first to create one!

You might also like..

Wat Moet Ons Met Ons Kerk Doen?
Jurie van den Heever Paperback  (1)
R311 Discovery Miles 3 110
Cave Of Bones - A True Story Of…
Lee Berger Paperback  (1)
R440 R393 Discovery Miles 3 930
Epigenetic Principles of Evolution
Nelson R Cabej Paperback R4,255 R3,549 Discovery Miles 35 490
Darwin's Pangenesis and Its Rediscovery…
Dhavendra Kumar Hardcover R3,710 Discovery Miles 37 100
Integrated Population Biology and…
Arni S.R. Srinivasa Rao, C.R. Rao Hardcover R6,219 Discovery Miles 62 190
Cerebral Lateralization and Cognition…
Gillian Forrester, Kristelle Hudry, … Hardcover R6,207 Discovery Miles 62 070
Popularizing Science - The Life and Work…
Krishna Dronamraju Hardcover R1,131 Discovery Miles 11 310
Speciation and Biogeography of Birds
Ian Newton Hardcover R2,417 Discovery Miles 24 170
The Origins of Evolutionary Innovations…
Andreas Wagner Hardcover R4,853 Discovery Miles 48 530
Measuring Metabolic Rates - A Manual for…
John R.B. Lighton Hardcover R1,962 Discovery Miles 19 620
The Evolution of Primary Sexual…
Janet Leonard, Alex Cordoba-Aguilar Hardcover R3,318 Discovery Miles 33 180
Exploring Personal Genomics
Joel T. Dudley, Konrad J. Karczewski Hardcover R4,218 Discovery Miles 42 180

See more

Partners