Infant Feeding is about a controversy which fascinated the medical and scientific world, as well as national and international health authorities, politicians, religious groups and consumer organisations, for more than 11 years. It often disturbed public opinion, being concerned, as it is, with nothing less than the life and death of babies. The infant food industry was directly accused of having caused a decline in breast-feeding through the inappropriate marketing of breast milk substitutes. The problem was said to be particularly acute in poor under-developed communities, because illiterate mothers were unable to understand instructions for its use, water was often contaminated and, in order to "stretch" an admittedly expensive product, it was over-diluted. The inevitable result, said the critics of industry, was malnutrition, gastroenteritis and increased infant mortality. These were very serious charges against companies which had until then been generally considered to provide an important contribution to medical progress and child health. One company was to be particularly singled out: Nestle SA, the Swiss multinational. Perhaps it became the target because it was the longest establishment, and served well as a symbol of the whole industry. It is a story which is full of confrontations, intrigue and passionately-held opinions, based, nevertheless, on a sizeable body of medical science. After countless twists and turns, it has some sort of "happy ending". Yet a great deal remains to be said, as will be seen throughout the book.

Although upstaged by the tragic appearance of the human immunodeficiency virus, herpes simplex viruses (HSV) types 1 and 2 continue to be major human pathogens against which we lack acceptable vaccines or other means of immunological control. The virus is large and complex, coding for 70 or more proteins. Although many mysteries remain to be unraveled, our knowledge base regarding genomic organization, gene expression and regulation, pathogenesis, and immune recog nition of component parts is quite considerable. Indeed, meet ings devoted entirely to herpesviruses are conspicuous by their frequency and excellent, yet sometimes exclusive, attendance. The purpose of this volume is to compile in a single book a series of reviews by leading investigators that deal with various aspects of virus-host interactions and which hopefully will pro vide clues as to how to best manage HSV from an immunobio logical perspective. Ultimately, one anticipates that a full under standing of virus-host interaction will lead to strategies useful for the prevention and control of HSV. The state of current progress with conventional vaccines is presented, as is a chapter on intracellular immunization. This latter novel approach to virus infections comes at approximately the bicentenary of Jenner's introduction of a successful conventional immunization strategy."

Helper T cells activate a set of lymphokine genes upon recognition of antigens presented in the context of the major histocompatibility complex on antigen presenting cells (Arai et al. , 1986; Miyajima et al. , 1988). Activation of T cells proceeds in two distinct stages. The flrst step is triggered by binding of an antigen to the T cell antigen receptor/CD3 complex that leads to the activation of protein kinase C (PKC) and an increase in intracellular Ca2+. This step, which is substituted by phorbol ester and calcium ionophore (Weiss et al. , 1984), possibly proceeds through GTP binding protein and phospholipase C. The second step is the downstream events of PKC activation for transmission of the intracellular signals to the nucleus and is likely to involve protein phosphorylation. In this review, we focus on the downwstream events of PKC activa- tion for activation of lymphokine genes. To characterize a series of biochemical reactions, we toke several approaches to (1) deflne the regulatory region of the GM-CSF and other lymphokine genes that mediates the response to T cell activation signals or viral transactivators, (2) develop a faithful in vitro transcription system of lymphokine genes which is dependent on regulatory sequence and activation signals, (3) characterize proteins that interact with the regulatory regions, and (4) search for critical target(s) for PKC activation. CLEl CLE2 GC box GGCCAGGAGATTCCACAACTCAGGTAGTTCCCCCGCCCCCCTGGAGTTCTGTGG -72 -60 -113 * -96 -84 GGAGATTCCCC IL-2R (p55) ...

M. B. A. OLDSTONE Viruses are generally studied either because they cause significant human, animal or plant disease or for their utility as materials to probe a basic phenomenon in biology, chemistry, genetics or molecular biology. Arenaviruses are unusually interesting in that they occupy both of these categories. Arenaviruses cause severe human diseases known primarily as the hemor rhagic fevers occurring in South and Latin America (Bolivia: Machupo virus and Argentina: Junin virus) and in Africa (Lassa virus). Because such viruses produce profound disability and may kill the persons they infect, they are a source of economic hardship in the countries where they are prevalent. Further, they provide new problems for health care personnel owing to the narrowing of the world as visitors from many countries increasingly travel to and from these endemic areas. In addition, lymphocytic choriomeningitis virus (LCMV) can infect humans worldwide, although the illness is most often less disabling than those elicited by other arenaviruses. Yet LCMV is likely of greater concern to non-arena-virologists and experimentalists using tissue culture or animals, i. e. , workers in molecular biology, cancer research, virology, immunobiology, etc. , because normal appearing cultured cells or tissues and animals used for research may be persistently infected with LCMV without manifesting clinical disease or cytopathology and transmit that infection to laboratory workers (reviewed OWSTONE and PETERS 1978). For example, HINMAN et al.

par Prof. Dr. E. VAN OYE, Bruxelles Les Salmonella constituent un groupe de germes parmi les plus repandus, les plus cosmo- polites et les plus ubiquitaires des microorganismes potientiellement pathogi'mes. On les rencontre chez tous les animaux a sang froid ou a sang chaud, du plus humble puceron aux plus impressionnants des mammiferes tels les baleines ou les e16phants. On les retrouve aussi partout dans Ie milieu ambiant, en particulier dans les eaux superficielles, qu'elles aoient douces ou salees. nest aiae de comprendre que les aliments les plus divera et les produits les plus inattendus en sont parfois contamimls. Non seulement les Salmonella jouent un role de premier plan dans la pathologie humaine et dans la pathologie animale mais egalement, vu leur ubiquiM, dans de nombreux sec- teurs de l'economie et non seulement celui de l'alimentation. La lutte contre les affections que ces germes provoquent - les salmonelloses - est avant tout baaee sur la prevention. Celle-ci, pour etre efficace, demande d'iltre informe aussi exactement que possible, sur l'identite des germes en cause. Or il existe de par Ie monde plus de 2000 especes differentes de Salmonella pouvant presenter d'innombrables varian- tes sur les plans de la serologie, de la biochimie ou de la lysotypie.

The fourth workshop on Mechanisms in B-Ce11 Neoplasia was held in Bethesda. Maryland. at the National Institutes of Health on March 24. 25 and 26. 1986. The meeting was attended by approximately 150 participants and 58 presentations were given. The purpose of these workshops and the yearly publications has been to provide a means for exchanging the rapidly developing information in this field and to bring maJor problems into focus. Edited trans- cripts of the 1983 and 1985 workshops were published by Editiones Roche Bas1e, Switzerland. Papers brought to the 1984 workshop were published in Current Topics in Microbiology and Immunology, Vol. 113. Numerous retrovira1 recombinant viral constructs are now in general use in a variety of test systems, both in vivo and in vitro. These are proving to have interesting bio10gica1-prQperties. ------- Kecent1y developed systems for inducing B cell tumors are described: 1) The development of spontaneous ~-ce11 tumors in transgenic mice carrying deregulated mlGBP genes and the Ig heavy chain promoter; 2) a method for inducing *p1asmacytomas in BAL~/c mice with short latent periods of ca 70 days by infecting pristane treated mice with retroviruses carrying various types of deregulated mlGBP genes; 3) induction of pre-B cell tumors with erbB containing recombinant retroviruses; 4) induction of B-ce11 and other tumors by infection of neonates with recombinant retroviruses. Several retrovira1 constructs containing mlGBP sequences do not induce B-ce11 tumors in pristane conditioned mice *.

African swine fever (ASF) is caused by a virus that is classified as a member of the Iridovirinae family. The disease in the warthog, the natural host, in Africa was described in 1921 by R. E. Montgomery. The reservoir of the vi rus is inti cks. The i ntroduct i on of domestic pi gs into territory occupied by warthogs i nf ected wi th ASF in the 1960's has endangered the pig industry around the world. The domestic pig is highly sensitive to ASF and develops a devastating disease that kills the pig without giving the immune system a chance to defend the animal against the virus infection. The ability of ASF virus to infect and destroy cells of the reticuloendothelial system leaves a defenseless host that succumbs to an infection which may be described as an acquired immune deficiency di sease of domestic pi gs. Introduction of the virus into Iberia in the 1960's led to a series of ASF epidemics in Spain and Portugal . . and later in France, that caused heavy economic losses. Between 1976 and 1960, ASF virus made its appearance in Malta and Sardinia . . as well as in Brazil, The Dominican Republic . . Haiti, and later in Cuba. In 1985-6 . . ASF appeared in Belgium and The Netherlands.

those who deal with infectious diseases on a daily This two volume work stems from the belief of the Editors that infectious diseases are not only very basis. much with us today but, more importantly, that they There are several excellent textbooks dealing will continue to playa significant global role in mor with medical microbiology, and there are equally well-recognized books devoted to infectious dis bidity and mortality in all people. A continuing need for an informed and knowledgeable community of eases. The Editors of this work, on the other hand, laboratory scientists is fundamental. Data describing were persuaded that there was a need for a publica the global impact of infectious diseases are difficult tion that would bring together the most pertinent and to come by. Fortunately, a recent thoughtful and relevant information on the principles and practice of provocative publication by Bennett et al. (1987) pro the laboratory diagnosis of infectious diseases and vides us with data derived from several consultants include clinical relationships. While this two volume that clearly delineate the impact of infectious dis text is directed toward the role of the laboratory in eases on the United States today."

It has been slightly more than two decades since the Epstein-Barr virus (EBV) was discovered by Prof. M.A. Epstein and his colleagues at the University of Bristol in their search for the causative agent of Burkitt's lymphoma. For several years EBV was a "virus in search of a disease." The first documentation that EBV was pathogenic for humans was in 1969 when Drs. Gertrude and Werner Henle identified it as the causative agent for infectious mononucleosis. Seroepidemiologic and biochemical studies subsequently linked EBV to Burkitt's lymphoma (BL), nasopharyngeal carcinoma (NPC), and more recently to the X-linked lymphoproliferative syndrome. With its widespread pattern of infection and a predilection for producing clinical signs and symptoms in only certain individuals, EBV has provided a model for many other candidate oncogenic viruses, including papilloma viruses, herpes simplex, and HTLV/LAV. In 1975, an international workshop was sponsored by the National Cancer Institute to address the problem of EBV production, thus facilitating basic research on the virus. This proved to be the last international meeting on EBV for almost a decade. In the past, progress in both clinical and basic research on EBV has been presented in two types of international meetings, the international herpesvirus workshops devoted primarily to basic research on both human and animal herpesviruses, and the international symposia on NPC, in which EBV-related studies were interspersed with clinical, epidemiologic and other etiologic aspects of this important human neoplasm.

Take a disease of complex pathology with inflammatory and neoplastic features, which affects lymphoid and neural tissues, belonging to a disease group which killed one chicken in five, and which defied efforts to understand and control it for lOre than 50 years, and one can begin to appreciate the interest Marek's disease has received. Canpound these characteristics with the finding of the causal herpesvirus, its recog nition as the neoplasm first discovered to be so caused, and its pre vention by vaccination, and the special place of Marek's disease in veterinary medicine and comparative oncology becomes clear. This book sets out to provide an authoritative and corrprehensive account of knowledge of Marek's disease and its control. I hope that it will be of value to veterinary research workers, teachers and students who need information about the disease, to veterinarians, poultrymen and vaccine manufacturers who have to diagnose and control it, and to oncologists in other fields interested in comparative aspects. other reviews of the disease exist, of course, but this is the first multi authored book devoted to the subject."

In recent years, papillomaviruses in general and human papillo maviruses in particular have been recognized as possible agents of important diseases, including some forms of human cancer. The purpose of this book is to present a concise panorama of the pre sent status of knowledge of this topic. This knowledge is as impor tant to molecular biologists and virologists as it is to clinicians and pathologists. To bridge the gap among these diverse groups of investigators, we conceived of a book covering a broad spectrum of the basic scientific, clinical, and pathological aspects of diseases associated with papillomaviruses. Although the principal thrust of this book is directed at human papillomaviruses, fundamental knowledge of animal viruses is essential to the current understand ing of the molecular mechanisms of cell transformation. For this reason, a chapter on animal viruses has also been included. Some of the experimental work having to do with the elucidation of transformation and other aspects of interaction between the virus and the cell cannot be based on human papillomaviruses because of a lack of suitable experimental models. Hence, some of the chapters dealing with fundamental aspects of viral molecular biol ogy are based on animal models. We were very fortunate in having persuaded a number of distin guished colleagues to contribute to this work."

Rabies is an ancient disease and a fearsome one. Although it may not have the economic or public health importance of some other infectious diseases, few are so well known or carry the same emotional impact. Mainly transmitted by the bite of an enraged animal, and with practically no hope for recovery among those afflicted, it has provided the substance of stories and legends throughout the ages. The pioneering work of many 19th century workers, culminating in the development of the first rabies vaccines by Louis Pasteur, provided the ground work for the modern era in the study of rabies. Since then, and particularly in the last quarter century, considerable advances have been made in our knowledge of the nature of the infectious agent, its mode of transmission and pathogenetic mechanisms. Yet even today, much remains to be learned about the disease. For example, although effective vaccines exist for humans and other animals, there is still no known practical cure once the neurological disease symptoms develop. Markers of virulence have been mapped at the molecular level, but it is yet unclear as to how rabies virus actually exerts its pathological effects.

Shortly after the reeognition of the aequired immunodefieieney syndrome (AIDS) in 1981 (1-3), it was hypothesized that herpesviruses may play an important role in the etiology or pathogenesis of this newly identified syndrome (4,5). This theory was based on the faet that infeetion with herpesviruses was a prominent elinieal feature in nearly all patients with AIDS (3-5). Chronie mueocutaneous herpes simplex virus (HSV) infections were one of the first opportunistie infeetions deseribed in patients with AIDS (3), and both cytomegalovirus (CMV) and HSV infections were extremely common in individuals identified to be at highest risk for aequiring AIDS, such as homosexual men, intravenous drug users and hemophiliaes (4-8). CMVand Epstein-Barr virus (EBV) were also prominent infeetions whieh were suspected as possible etiologic agents of the prolonged fever, wasting, and Iymphadenopathy that often precedes AIDS, frequently referred to as the chronie Iymphadenopathy syndrome (9,10). Subsequent elinieal studies have indeed demonstrated that infeetions with HSV, CMV, EBV, and even varieella zoster virus (VZV) are frequent opportunistic infeetions wh ich oeeur among AIDS patients (11-14). Several of the opportunistie infeetions caused by herpesviruses include encephalitis, chorioretinitis, hairy leukoplakia, esophagitis, enteritis, colitis, Burkitt's lymphoma, primary CNS lymphoma, zoster, and there has even been speculation about the role of CMV in the pathogenesis of Kaposi's sareoma (15,16). Furthermore, the herpesviruses, partieularly CMV and EBV have been known to be strongly associated with immunosuppression, partieularly of cell-mediated immune functions, which further supported the hypothesis that herpesviruses may contribute to the immune defects that eharacterize AIDS."

Most of the chapters of this book were written during 1987 which was the Diamond Jubilee year of the publication of the first reports of Newcastle disease in 1927. During the intervening years the nature of the Poultry Industry throughout the World has changed, or is in the process of changing, dramatically from one based on small village or farm flocks, frequently kept as a sideline, to an industry based on large flocks, sometimes consisting of hundreds of thousands of birds, run by multinational companies. To all these flocks, both large and small, Newcastle disease poses a considerable threat to their well-being and profitability and it is not unreasonable to state that hardly a single commercial flock of poultry is raised in the world without Newcastle disease having some effect due to actual disease, prophylactic vaccination or restrictions placed on rearing, movement, processing, sale or export of birds and products. In addition, recent years have produced developments in virology and associated biological technology which would have been unbelievable when Newcastle disease virus was first isolated. The economic importance of Newcastle disease virus and its use as a laboratory model has meant that major advances have been quickly applied to the field situation whenever possible and, as a result, a much fuller understanding, not only of the biochemistry and basic virology of the virus but also the ecology, epizootiology, antigenicity, immunology and other important aspects in the control of the disease has been achieved.

The time seems ripe for a critical compendium of that segment of the biological universe we call viruses. Virology, as a science, having passed only recently through its descriptive phase of naming and num bering, has probably reached that stage at which relatively few new-truly new-viruses will be discovered. Triggered by the intellectual probes and techniques of molecular biology, genetics, bio chemical cytology, and high resolution microscopy and spec troscopy, the field has experienced a genuine information explosion. Few serious attempts have been made to chronicle these events. This comprehensive series, which will comprise some 6000 pages in a total of about 18 volumes, represents a commitment by a large group of active investigators to analyze, digest, and expostulate on the great mass of data relating to viruses, much of which is now amorphous and disjointed, and scattered throughout a wide literature. In this way, we hope to place the entire field in perspective, and to develop an invalua ble reference and sourcebook for researchers and students at all levels. This series is designed as a continuum that can be entered anywhere, but which also provides a logical progression of developing facts and integrated concepts."

Protecting Infants through Human Milk: Advancing the Scientific Evidence provides a forum in which basic scientists, clinicians, epidemiologists, and policy makers exchange the latest findings regarding the effects of human milk and breastfeeding on infant and maternal health, thereby fostering new and promising collaborations. This volume also integrates data from animal and in vitro laboratory studies with clinical and population studies to examine human milk production and composition, the mechanisms of infant protection and/or risk from human milk feeding, and proposed interventions related to infant feeding practices. Additionally, it stimulates critical evaluation of, and advances in, the scientific evidence base and research methods, and identifies the research priorities in various areas.

The nucleotide sequence of the gene from which messenger RNA mole cules are transcribed is in a form that can be translated by cellular ribosomes into the amino acid sequence of a particular polypeptide, the product of the gene. The discovery of messenger RNA more than twenty years ago led to a series of studies on its organization and function in cells in the presence of infecting viruses. This volume is devoted to current studies in the field of cellular and viral messenger RNA. The studies presented provide an insight into molecular and genetic aspects of messenger RNA. Special attention was paid by the authors to the molecular organization of mRNA species, to the processing of mRNA molecules, and to the different strategies employed by DNA and RNA viruses in the synthesis of their mRNA. The ability of a virus to take over the protein-synthesizing mechanisms of an infected cell depends on its ability to produce mRNA molecules which can affect the host mRNA or utilize cellular components more efficiently. The differences between, and similarities of, the strategies of mRNA synthesis devised by various DNA and RNA viruses are described herein. This book should be of interest to all students of cellular and viral genes and scientists in the field. It is suitable as a textbook for workshops and courses on mRNA. I wish to thank the authors for their fine contributions and for their interest."

During the past few decades we have witnessed an era of remarkable growth in the field of molecular biology. In 1950 very little was known of the chemical constitution of biological systems, the manner in which in formation was transmitted from one organism to another, or the extent to which the chemical basis of life is unified. The picture today is dramati cally different. We have an almost bewildering variety of information detailing many different aspects of life at the molecular level. These great advances have brought with them some breath-taking insights into the molecular mechanisms used by nature for replicating, distributing and modifying biological information. We have learned a great deal about the chemical and physical nature of the macromolecular nucleic acids and proteins, and the manner in which carbohydrates, lipids and smaller mole cules work together to provide the molecular setting of living systems. It might be said that these few decades have replaced a near vacuum of information with a very large surplus. It is in the context of this flood of information that this series of mono graphs on molecular biology has been organized. The idea is to bring together in one place, between the covers of one book, a concise assess ment of the state of the subject in a well-defined field."

'!he present volune Herpesvirus Diseases of cattle, Horses and pigs in the series "Developnents in Veterinal:y Virology" gives a review on herpesvirus infections in (a) cattle by bovine herpesvirus I (lEV-I), lEV-2 and lEV-4, alcelaphine herpesvirus I (malignant catanbal. fever) and Aujeszky"s disease virus, (b) horses by equine herpesvirus I (EHV-1), EHV-2 and EHV-3 and (c) pigs by Aujeszky's disease virus and porcine cytomegalovirus. Some of these viruses also infect small ruminants, therefore sheep and goats are included in this review as far as they are concemed. The different chapters include the latest knowledge on the viruses and the resulting diseases. Bearing in m:irrl the rapid development of oolecular biology and genetechnology in the last years a comprehensive survey on the oolecular aspects of the viruses and genetically engineered vaccines is presented, as far as data have been available. However, the other fields have not been neglected. large space is given to the description of clinical synptams, pathology, pathogenesis, latent infection, physical, chemical and biological characteristics of the viruses, hmnoral and cell-mediated imnunity, vaccines and vaccination, epizootiology, control, eradication, economics considerations and future aspects.

A great truth is a truth whose opposite. is also a great truth. Thomas Mann (Essay on Freud, 1937) This volume centers on pseudorabies (PR V), herpes simplex viruses 1 and 2 (HSV-1 and HSV-2), and human cytomegalovirus (CMV) and fulfills three objectives. The chapters on the epidemiology and latency of HSV, and on the glycoproteins specified by HSV and CMV, set the stage for the discussions of the immunobiology and pathogenesis of human herpesvirus infections in Volume 4. The epidemiology of HSV is the basis of our understanding of the spread and survival of this virus in the human populations. Central to the epidemiology of HSV and its pathogenesis in humans is the ability of the virus to remain in a latent state for the life of its host. The viral membrane glycoproteins are among the most interesting virion proteins, primarily because of their critical role in the initiation of infection. Since they are the surface membrane proteins of the virion and appear on the surface of productively infected cells, they are also the obvious if not the exclusive targets of the immune response. The chapters on the transforming potential of HSV and CMV, and on the role of HSV in human cancer, deal with challenging problems requiring rather different experimental tools.

During the past two decades, virus taxonomy has advanced to the point where most viruses can be classified as belonging to families, genera, or groups of related viruses. Virus classification is primarily based on chem ical and physical similarities, such as the size and shape of the virion, the nature of the genomic nucleic acid, the number and function of com ponent proteins, the presence of lipids and of additional structural fea tures, such as envelopes, and serological interrelationships. The families, genera, or groups of viruses that have been defined on the basis of such criteria by the International Committee on Taxonomy of Viruses (ICTV) will be described in some detail in this catalogue and illustrated by elec tron micrographs. In my present attempt to list most if not all well es tablished and studied viruses in alphabetical order, I have largely confined myself to identifying them only in such taxonomic terms, generally without quoting specific data reported for individual viruses. If the latter data do not at times agree closely with those given for the taxon or group, it is difficult to decide to what extent this is attributable to misclassi fication due to insufficient data and errors in the analytical procedures and descriptions, or to what extent this is an expression of Nature's free dom of choice and abhorrence of restrictive classifications."

The development of recombinant DNA technology has made a marked impact on molecular virology. The cleavage of viral DNA genomes with restriction enzymes and the cloning of such DNA fragments in bacterial p1asmids has led to the amplification of selected viral DNA fragments for sequencing and gene expression. RNA virus genomes which can be transcribed to their cDNA form were also cloned in bacterial p1asmids, facilitating the study of RNA virus genes. With the elucidation in recent years of the promoter sequence of various viral genes and the expression of these genes in bacteria or yeast, the understanding of many viral gene functions has made great progress. Cloning and expression of viral genes in mammalian cells was made possible by the construction of shuttle plasmid vectors which carry the origins of DNA replication from bacteria and/or mammalian viruses. The expression of viral genes in bacteria, yeast and eukaryotic cells gives reason to hope that it will be possible to produce viral antigens in large quantities for use as human or animal vaccines. The present volume attempts to capture for the reader some of the high lights of recombinant DNA research in the field of animal and plant viruses."

During the last 5 years, major advances have been made in our understanding of the pathogenesis of human immunodeficiency virus (HIV) disease and in the development of new potent antiviral agents. With regard to HIV pathogenesis, several recent observations have not only changed our perspectives of HIV disease, but have been critical for the design of therapeutic strategies.

If ripple effect is a measure of greatness in scientific discovery then GEMMOs have a lot going for them and this book dramatically illustrates the risks associated with advances being made by researchers to mobilize and control the power of the microorganism in the world's fight to perfect nature and fmd remedies for its imperfections. In the field of genetic science it is abundantly clear that so much more can be achieved through prevention rather than cure and that the indirect kill, by reason of its logic is a much more powerful weapon for winning results. Nevertheless the dilemma facing politicians arises over whether man should tamper with something which is God-given such as Radioactivity and Genetic endowment. The Roman Catholic church fmds difficulty in accepting the proposition that what is God given can be treated as a product under human control and maybe that is why recently half a century of genetic research on a strain of bees resistant to a devastating parasite at the Buckfastleigh Benedictine Monastery has inexplicably ceased whilst verging on scientific success.(l) The Anglican Community on the other hand does not see the sacrosanctity of Radioactivity and Genetic material as a bar to man-manipulation with appropriate safeguards.