Virus diseases continue to represent serious health problems in most parts of the world. In spite of the fact that diseases such as polio myelitis and measles have been controlled in the industrialized countries by vaccination, vaccines now in use in tropical countries have proved not to be optimal. Further research is needed to develop new vaccines that will be effective in all countries. To do so we need to understand better the immune response to different viruses so that we may be able to maxi mize the protective response of new vaccines and minimize their potential immunopathologic effect. An exciting new discovery which is now being further developed is the possibility of being able to use some viruses (e.g. vaccinia, adenoviruses, etc.), as carriers for other antigens. This may open up the way for the production of vaccines that will be inexpensive and that will confer long lasting immunity after only one injection. This meeting has also served to review our present knowledge of virus diseases which are still of great importance such as hepatitis, dengue and influenza."

No one whose opinion deserves a moment's consideration can doubt that most of the great positive evils of the world are in themselves removable, and will, if human affairs continue to improve, be in the end reduced to narrow limits. J. S. Mill, Utilitarianism, II, 1863 Mill was not writing about herpesviruses, but had he known them as we do, he would have included them among the great positive evils of the world. They cause disease and premature death, and are very costly to our society. There is no loftier aim than to cure or prevent human infections with these viruses. The objective of much of the current research on herpesviruses is directed toward an understanding of the molecular mechanisms involved in initiation of infection, establish ment and termination of latent state, virus multiplication, and the destruction of cells which ultimately is the basis of the diseases caused by these viruses. At no time during the past 80 years, since members of the herpesvirus family were first discovered, has there been so much progress in our understanding of the biology of these viruses as in the past few years. Along with the development of a greater understanding of the molecular biol ogy of the well-known herpesviruses we have witnessed the isolation of new human herpes viruses.

During the past few decades we have witnessed an era of remarkable growth in the field of molecular biology. In 1950 very little was known of the chemical constitution of biological systems, the manner in which in formation was transmitted from one organism to another, or the extent to which the chemical basis of life is unified. The picture today is dramati cally different. We have an almost bewildering variety of information detailing many different aspects of life at the molecular level. These great advances have brought with them some breath-taking insights into the molecular mechanisms used by nature for replicating, distributing and modifying biological information. We have learned a great deal about the chemical and physical nature of the macromolecular nucleic acids and proteins, and the manner in which carbohydrates, lipids and smaller mole cules work together to provide the molecular setting of living systems. It might be said that these few decades have replaced a near vacuum of information with a very large surplus. It is in the context of this flood of information that this series of mono graphs on molecular biology has been organized. The idea is to bring together in one place, between the covers of one book, a concise assess ment of the state of the subject in a well-defined field."

Parasitic Disease in Clinical Practice is the sixth monograph to appear in the now established and flourishing Bloomsbury Series in Clinical Science. Written by a distinguished authority in the field, the book gives a comprehensive and detailed description of parasitic infections and their clinical consequences. Such infections are no longer confined to tropical parts of the world and now have a widespread distribution. Rapid advances are being made in understanding their epidemiology and in diagnosing and treating particular infections. Current literature is largely directed to the parasites, their characteristics and their isolation; a clinical review is clearly needed. This has now been provided, for the author's stated objective is to "inculcate a greater awareness, understanding and appreciation of human parastic disease in the minds of all clinicians". London, March 1990 Jack Tinker Preface Homo sapiens has always existed in a finely balanced equilibrium with a great diversity of infective agents, almost all of them of great antiquity. Many must have exerted a profound effect on the evolution of the human genome. While the average physician is usually aware of potentially pathogenic viruses, bacteria (and rickettsia), and to a lesser extent fungi, hislher knowledge of protozoan and helminthic infections is frequently imperfect and often rudimentary.

Helper T cells activate a set of lymphokine genes upon recognition of antigens presented in the context of the major histocompatibility complex on antigen presenting cells (Arai et al. , 1986; Miyajima et al. , 1988). Activation of T cells proceeds in two distinct stages. The flrst step is triggered by binding of an antigen to the T cell antigen receptor/CD3 complex that leads to the activation of protein kinase C (PKC) and an increase in intracellular Ca2+. This step, which is substituted by phorbol ester and calcium ionophore (Weiss et al. , 1984), possibly proceeds through GTP binding protein and phospholipase C. The second step is the downstream events of PKC activation for transmission of the intracellular signals to the nucleus and is likely to involve protein phosphorylation. In this review, we focus on the downwstream events of PKC activa- tion for activation of lymphokine genes. To characterize a series of biochemical reactions, we toke several approaches to (1) deflne the regulatory region of the GM-CSF and other lymphokine genes that mediates the response to T cell activation signals or viral transactivators, (2) develop a faithful in vitro transcription system of lymphokine genes which is dependent on regulatory sequence and activation signals, (3) characterize proteins that interact with the regulatory regions, and (4) search for critical target(s) for PKC activation. CLEl CLE2 GC box GGCCAGGAGATTCCACAACTCAGGTAGTTCCCCCGCCCCCCTGGAGTTCTGTGG -72 -60 -113 * -96 -84 GGAGATTCCCC IL-2R (p55) ...

On the occasion of a research visit to Thailand in my capacity as a member of the governing board of the South Asia Institute of the University of Heidelberg, I saw for the first time the severe clinical picture of dengue with haemorrhagic symptoms among Thai children. This visit had been made possible by Profes sor Dr. med. Dr. rer. nat. Ouay Ketusinh of Bangkok, to whom I wish to express my sincere thanks in this place. In 1972 the German medical literature - the periodical Medizinische Klinik, vol. 87, pp. 152-56, to be precise - had drawn attention to this new phenomenon in the disease panorama of South East Asia, indicating a change in dengue fever from being a relatively benign tropical dis ease to a form having serious clinical and epidemiological ramifications. During the ten years following my first publication the new clinical picture, described as "dengue haemorrhagic fever," has become a standard component in the Thailand's system of notifiable diseases. So too, the World Health Orga nization publishes regular reports in its Weekly Records. On March 30/31, 1981, its Regional Office for South East Asia convened a special conference in New Delhi, thus emphasizing the significance of the diffusion of this new clini cal picture in the states of South East Asia."

Severe sepsis and septic shock are the most serious compli cations of bacterial infections. Both gram-positive and gram negative bacteria can trigger these extreme inflammatory re sponses and, by so doing, cause substantial morbidity and mortality. In the United States alone, over 400 000 patients suffer from septicaemia each year, and approximately 100 000 of these patients die despite optimal intensive care and modern antimicrobial therapy. These dramatic figures have prompted intensive research to define the bacterial and host factors involved in the septic response. Scientists from many disciplines, including chem istry, physics, biology, medical microbiology, immunology, and pharmacology, have worked closely with clinicians to achieve rapid and profound progress. To translate this newly acquired knowledge into clinical practice, clinical trials have also been performed to evaluate numerous new therapeutic drugs. The disappointing results from these trials have underscored a major lesson, namely, that sepsis constitutes an extremely complex syndrome and that basic and clinical research must be greatly intensified in order to illuminate its molecular mechan isms. At this stage, the editors of the present volume of Current Topics in Microbiology and Immunology considered it would be rewarding to compile a volume summarizing our present basic and clinical knowledge on sepsis. Our particular gratitude extends to those international experts who have followed our invitation and elaborated on particular areas of the basic and clinical aspects of this field."

I assume that you already know a good deal of microbiology. In this book, I frequently use the word "we" by which I mean "you and I." Together we are going to consider bacteriology from a broader perspective and we will think our way through the important biological problems that are frequently just skipped over in every microbiology course. My most important reason for writing this book is to make accessible the relevant thinking from fields of science other than microbiology that are important to microbiology. The book is written for people that have already have a fascination with bacteria, but can see that their background for understanding is far complete. This book consists of topics that are largely omitted from microbiology textbooks and includes some mathematics, physics, chemistry, and evolutionary biology. It contains a good deal of my own work, both experimental and theoretical, together with a lot of speculation. If ten times bigger, it would be a full text book on microbial physiology. A third of the microbial physiology is covered by the recent is no longer treated even in textbook by White (2000). Another third current specialized tests and is greatly underrepresented in text books.

The physiology of the semicircular canals was my main research interest before I began to study their morphology. In 1966, by utilizing the isolated semicircular canal of the frog, I was able to show that cell activity in the horizontal semicircular canal has the opposite polarity to that in the vertical canals, which was the first physiological proof of Ewald's law. Several transmitting electron microscope (TEM) studies had already reported on the morphology of the semicircular canal cristae; however, my morphological work was motivated by a strong desire to see whether the morphological polarity accorded to the physio logical polarity. In 1968 I happened to see the paper written by Dr David Lim, one of my close friends. His findings concerning the vestibular morphology, when examined by scanning electron microscopy (SEM), fascinated me a great deal because of the three-dimensional quality of the micro graphs. This stimulated me to become involved in vestibular morphol ogy. In the beginning, however, I faced many problems with specimen preparation for SEM, and the first few years were spent simply solving technical problems, especially those of artifacts. Many of the figures in this book have been photographed with a JEOL JSM U-3 scanning electron microscope over a decade. The sharpness of these pictures still, I think, bears comparison to the defi nition of those taken by the more sophisticated SEM scopes currently available."

Mter the discoveryof the tobacco mosaic virus by D. I. Ivanov skU in 1892 14], the new science of virology was born and began to develop rapidly. The number of viruses now known is enormous and they can infect nearly all animal and plant organisms. Microorganisms themselves are no exception to this rule. Despite intensive study of Vlruses, their origin and nature are still a subject for speculation and hypothesis. The general concept of viruses embraces a wide group of biologically active structures occupying an intermediate position between living and nonliving matter. The dual character of viruses is determined by the fact that, while they do not possess an inde pendent system of metabolism, which is a characteristic feature of every living being, they nevertheless carry within themselves all the necessary information for autoreproduction. A striking feature of the virus is that it consists essentially of two components: a protein envelope and the nucleic acid con tained within it. In contrast to the elementary structural unit of the living or ganism, the cell, which contains two types of nucleic acid (DNA and RNA), the virus particle contains only one type of nucleic acid - either DNA or RNA. It is perhaps this which is responsible for the imperfection of the virus as a living organism."

Flow cytometry has rapidly evolved into a technique for rapid analysis of DNA content, cellular marker expression and electronic sorting of cells of interest for further investigations. Flow cytometers are being extensively used for monitoring of cellular DNA content, phenotype expression, drug transport, calcium flux, proliferation and apoptosis. Phenotypic analysis of marker expression in leukemic cells has become an important tool for diagnostic and therapeutic monitoring of patients. Recent studies have explored the use of flow cytometry for monitoring hormone receptor expression in human solid tumors and for studies in human genomics. Contributions in the current volume are based on presentations made at the First Indo-US workshop on Flow Cytometry in which experts from USA, UK and India discussed applications of flow cytometry in biological and medical research. This book will be of interest to post graduates and researchers in the fields of pathology, cytology, cell biology and molecular biology.

This volume is the third in the series devoted to Antibiotics initiated by Springer Verlag in 1967. The first two volumes were devoted to the Mode of Action of Antibiotics and Biogenesis, respectively and were received graciously. During the intervening years these two works have been used often by research workers and students alike and have been quoted extensively. Although a number of other excellent treatises on antibiotics have appeared, the Springer series has set a standard for thoroughness and quality that meets the need of the scientific community. It is against this background that the present Editors set about the preparation of a third volume in the Series on Antibiotics. Since the appearance of Volume I, also dealing with Mechanism of Action, tremendous strides have been made in the depth and breadth of our knowledge of molecular biology, microbial chemistry and molecular pharmacology and of their direct application to studies on the mode of action of drugs. The field of molecular biology itself was in its relative infancy during the preceding decade and the unique role played by many anti biotics in the development of our understanding of nucleic acid synthesis and function and its relationship to protein synthesis and cell physiology has led rapidly to a very precise, understanding of how many of these same antibiotics inhibit susceptible cells."

Organisms are constantly being bombarded by stimuli in their envi ronment (and also by internal stimuli), and a common way of responding is by movement. This is an aspect of irritability, or excitability, or behaviour. Response to stimuli by movement is found in all organisms: it represents one of the universalities of biology. Yet at the molecular level it is one of the least understood of biological phenomena. Micro-organisms are no exception. If motile, they respond to stimuli by active movement (taxis); if sessile, they respond by growth movements (tropisms). Responses by movement are known among micro-organisms to such stimuli as chemicals, electric current, gravity, light, temperature, touch, and vibrations. The behaviour of micro-organisms is an exciting subject, first of all for its own sake, but in addition because it may reveal facts and concepts that are applicable to understanding behaviour in more complicated organisms (even us) and because it may, help to understand the movement of cells and tissues during differentiation and development of higher plants and animals.

In recent years remarkable progress has been accomplished with respect to our knowledge about bacterial protein toxins. This refers especially to structural aspects of protein toxins but also holds true for genetics, molecular biology and biochemical mechanisms underlying the action of toxins. This volume covers the very current and exciting aspects of up-to-date bacterial toxicology and comprehensively reviews the most important bacterial protein toxins such as the intracellular acting toxins which exhibit enzyme activity, as well as those toxins that interact with cell plasma membranes by damaging the membranes (pore formation) or stimulating cell receptors (superantigens). This is the most current reference work on these important bacterial protein toxins, which are presented from the point of view of different disciplines such as pharmacology, microbiology, cell biology and protein chemistry.

Strategies of Bacterial Interaction with Eukaryotic Cells *Tobias A. Oelschlaeger and Jorg Hacker 1. BENEFICIAL BACTERIAL-HOST INTERACTIONS Already during birth and soon thereafter mammals are colonized by bacte- ria belonging to the resident microbial flora. Cutaneous and mucosal sur- faces and the gastrointestinal tract are the areas which become colonized. These indigenous or autochthonous bacteria have a variety of beneficial effects on their hosts. They play a protective role by bacterial antagonism in fighting infections (Hoszowski and Truszczynski, 1997; Hentges, 1979). Pro- duction of vitamin K is another essential contribution of the resident microbial flora to the health of the host (Hill, 1997). Even more important, studies with germ-free animals demonstrated the involvement of the microbial flora on the development of the immune system. Such animals have underdeveloped and relatively undifferentiated lymphoid tissues and low concentrations of serum immune globulins ( Cebra et at., 1998). They TOBIAS A. OELSCHLAEGER and JORG HACKER Institut filr Molekulare lnfektionsbiologie, Universitiit Wiirzburg, 97070 Wiirzburg, Germany. *Corresponding author; Phone: (0)931-312150; FAX: (0)931-312578; E-mail: [email protected] xxix Tobias A. Oelschlaeger and Jorg Hacker also show defects in specific immune responsiveness and in nonspecific resistance induced by endotoxin, which may account for their lowered resis- tance. A more typical example of symbiotic interaction of bacteria with a host are bacteria like Ruminococcus in the gut of ruminants, essential for degradation of cellulose (Hobson, 1988). The closest benefical bacterial-host interactions are those of intracellular symbiotic bacteria and their host cells.

This volume contains the Proceedings of the 4th International Conference on Ticks and Tick-borne Pathogens (TTP-4), held in Banff, Alberta, Canada, from 21 to 26 July 2002. TTP-4 continues an important tradition established in 1992 at the first Conference in St. Paul, Minnesota, USA, and developed subsequently at the Kruger National Park, South Africa (1995) and the High Tatra Mountains, Slovakia (1999). The 31 papers published in this special issue are divided between six sessions, with a keynote address as an introduction. The first session, which deals with biosystematics, genomics and proteomics of ticks, contains the most recent world list of valid tick names. The papers deal with a broad range of tick-host-pathogen interactions, including remote sensing and mapping of ticks and tick-borne pathogens as well as practical aspects of tick control. It is recommended reading for anyone working on ticks and tick-borne pathogens, which are of increasing medical and veterinary importance worldwide.

Bacterial infections affect world health today as a leading cause of morbidity and mortality. This book presents in-depth methods and state-of-the-art protocols for investigating specific mechanisms of pathogenesis for a wide range of bacteria. Written by experts in the field, this invaluable collection includes protocols to study host-pathogen interactions, animal models of infection, and novel approaches to identifying therapeutic targets designed to control infections.

The threat of bioterrorism has become a major challenge for the twenty-?rst century. However, the potentials of infectious agents as bioweapons have been recognized for centuries. Throughout history there have been attempts to i- tiate infectious disease outbreaks and epidemics during warfare. In the last decade the attention of the biomedical community, as well as governments and the United Nations, has increasingly focused on the threat of bioterr- ism, especially the use of biological and/or chemical weapons against military and civilian populations. As an example, there is now much interest conce- ing microbial infection and bioterrorism in the medical microbiology and - munologycommunities. Thisvolumeaddressessuchconcernsandemphasizes bothbasicandclinicalconcepts, aswellasproblematicimplicationsofinfection by various microbes now recognized as potential bioterrorism agents. The ?rst chapter by Drs. Andrew Canons, Philip Amuso, and Burt And- son from the University of South Florida is an overview of the biotechnology of bioterrorismbothinthepublichealthresponsetopossibleactsofbioterrorism, aswellasfortheconcernsaboutthemisuseofbiotechnology. Thesecondch- ter is a historical perspective of microbial bioterrorism by Dr. Steven Morse, Director of the Bioterrorism Division at the Center for Disease Control and Prevention in Atlanta, GA. This chapter describes in detail historical aspects concerning the early use of biological agents in warfare, development and international conventions to prohibit the use of such weapons, and a brief - scription of important incidents of infectious agents as bioterrorist agents and use during the last few centuries. The next chapter by Dr. Sandra Gompf from the University of South Florida discusses the role of public health physicians and infectious diseases specialists in the control of microbial bioterrorism

This book records the papers and discussions at a Work shop which took place in London on the 5th and 6th of April 1979, as part of the programme of the Commission of the European Communities on Medical and Public Health Research. However the views expressed are those of the individuals concerned and not of the EEC or any of its organs. The object was to discuss certain biological aspects of natural and experimental slow virus infections. Because the amount of knowledge and the focus of interest varied in respect of each infection the approach and emphasis varied also. In the case of scrapie, we discussed the nature of the agent and the mode of pathogenesis, in the case of SSPE, the search for unusual features of the virus, and recent detail ed work on the immunology of the disease. As for Visna we reviewed the present understanding of the virus and its pathogenicity and also field epidemiology and methods for its control. There were also general papers, on interferon and oncornaviruses for example. We thank all those who made the meeting possible and enabled us to produce this book quickly, so that those who could not attend the meeting may nevertheless be able to read a great deal of what went on at it. In particular we would thank the Ciba Foundation who allowed us the use of their premises and Mrs. Jean Ashley who dealt with most of the arrangements."

The application of enzymes or whole cells (fermentatively active or resting; microbial, plant, or animal) to carry out selective transformations of commercial importance is the central theme of industrial biocatalysis. Traditionally, biocatalysis has been in the domain of the life scientist or biochemical engineer. However, recent advances in this field have enabled biocatalytic processes to compete head on with, and in some cases out perform, conventional chemical processing. Chemo-biocatalytic systems are being developed thereby combining the most attractive features of bio catalysts, namely high specificity, with those of chemical catalysts, such as high reactivities and wide substrate specificities. Hence, synthetic chemists and chemical engineers are now beginning to use biocatalysts as highly selective reagents in chemical synthesis and processing. This book is about biocatalysts and their past, present, and potential applications in the food, pharmaceutical, and chemical industries. The con cept of the book did not emanate from a meeting. Rather, it is a compila tion of selected examples where biocatalysis either has already made a significant impact in the aforementioned industries, or has the potential to make a substantial contribution. I have been fortunate to have assembled contributions from world-class researchers in the field of biocatalysis. Their timely contributions are sincerely appreciated."

Opportunistic Infections: Toxoplasma, Sarcocystis, and Microsporidia will focus on two important Genera of Apicomplexan parasites, Toxoplasma gondii and Sarcocystis species, and the medically important members of the Phylum Microsporida. We have been fortunate in obtaining excellent contributions from many experts in the field.
Volumes in the "World Class Parasites" book series are written for researchers, students and scholars who enjoy reading about excellent research on problems of global significance. Each volume focuses on a parasite, or group of parasites, that has a major impact on human health, or agricultural productivity, and against which we have no satisfactory defense. The volumes are intended to supplement more formal texts that cover taxonomy, life cycles, morphology, vector distribution, symptoms and treatment. They integrate vector, pathogen and host biology and celebrate the diversity of approach that comprises modern parasitological research.

The soil-transmitted nematode parasites, or geohelminths, are - called because they have a direct life cycle, which involves no intermediate hosts or vectors, and are transmitted by faecal contamination of soil, foodstuffs and water supplies. They all inhabit the intestine in their adult stages but most species also have tissue-migratoryjuvenile stages, so the disease manifestations they cause can therefore be both local and systemic. The geohelminths together present an enormous infection burden on humanity. Those which cause the most disease in humans are divided into three main groupings, Ascaris lumbricoides (the large roundworm), Trichuris trichiura (whipworm), and the blood-feeding hookworms (Ancylostoma duodenale and Necator americanus ), and this book concentrates on these. These intestinal parasites are highly prevalent worldwide, A. lumbricoides is estimated to infect 1471 million (over a quarter ofthe world's population), hookworms 1277 million, and T. trichiura 1049 million. The highly pathogenic Strongyloides species might also be classified as geohelminths, but they are not dealt with here because the understanding of their epidemiology, immunology and genetics has not advanced as rapidly as for the others. This is primarily because of the often covert nature of the infections, with consequent difficulties for analysis. If there is ever a second edition of this book, then there will hopefully be much to say about this infection.

Shortly after the reeognition of the aequired immunodefieieney syndrome (AIDS) in 1981 (1-3), it was hypothesized that herpesviruses may play an important role in the etiology or pathogenesis of this newly identified syndrome (4,5). This theory was based on the faet that infeetion with herpesviruses was a prominent elinieal feature in nearly all patients with AIDS (3-5). Chronie mueocutaneous herpes simplex virus (HSV) infections were one of the first opportunistie infeetions deseribed in patients with AIDS (3), and both cytomegalovirus (CMV) and HSV infections were extremely common in individuals identified to be at highest risk for aequiring AIDS, such as homosexual men, intravenous drug users and hemophiliaes (4-8). CMVand Epstein-Barr virus (EBV) were also prominent infeetions whieh were suspected as possible etiologic agents of the prolonged fever, wasting, and Iymphadenopathy that often precedes AIDS, frequently referred to as the chronie Iymphadenopathy syndrome (9,10). Subsequent elinieal studies have indeed demonstrated that infeetions with HSV, CMV, EBV, and even varieella zoster virus (VZV) are frequent opportunistic infeetions wh ich oeeur among AIDS patients (11-14). Several of the opportunistie infeetions caused by herpesviruses include encephalitis, chorioretinitis, hairy leukoplakia, esophagitis, enteritis, colitis, Burkitt's lymphoma, primary CNS lymphoma, zoster, and there has even been speculation about the role of CMV in the pathogenesis of Kaposi's sareoma (15,16). Furthermore, the herpesviruses, partieularly CMV and EBV have been known to be strongly associated with immunosuppression, partieularly of cell-mediated immune functions, which further supported the hypothesis that herpesviruses may contribute to the immune defects that eharacterize AIDS."

The second volume of Arenaviruses deals with the biology and the pathogenesis of arenaviruses primarily through the study of LCMV. Interestingly and appropriately, the fundamental observation of MHC restriction and CD8 cytotoxic T lymphocyte killing derived initially from studies with LCMV in the mouse has been expanded to studies of most human pathogens, viral, bacterial, parasitic, as well as events in cancer. The scope and importance of this observation was recognized by awarding the Nobel Prize in 1996 to Rolf Zinkernagel and Peter Doherty, long-time workers in the field of LCMV and arenavirus biology. Over the last 14 years many of the principles for understanding viral pathogenesis and biology of animal viruses have been defined, in great part from the lessons learned by studying LCMV. Those lessons and their implications are the subject of this second volume on the arenaviruses.